Sequence ID | >W1710081335 |
Genome ID | BDFE01000009 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfoplanes formicivorans [BDFE] |
Start position on genome | 46987 |
End posion on genome | 47062 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tcttcagacg |
tRNA gene sequence |
GTGGATGTAGCTCAGTTGGTAGAGCTCCTGGTTGTGGCCCAGGTGGCCGCGTGTTCAAGT |
Downstream region at tRNA end position |
caaacaaaag |
Secondary structure (Cloverleaf model) | >W1710081335 His GTG g CCCA caaacaaaag G - C T - A G - C G - C A - T T - A G - C T G T T G C A C A T G A A + | | | | A T C T C G G C G T G C G | | | | T T G G A G C T A T TGGCC C - G C - G T - A G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |