Sequence ID | >W1710085875 |
Genome ID | BDNR01000141 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium avium subsp. hominissuis [BDNR] |
Start position on genome | 5222 |
End posion on genome | 5147 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ggcggccatg |
tRNA gene sequence |
GTGGCTGTAGTTCAGCTGGTAGAGCACCAGGTTGTGATCCTGGGTGTCGCGGGTTCGAGT |
Downstream region at tRNA end position |
ccggtcggcc |
Secondary structure (Cloverleaf model) | >W1710085875 His GTG g CCCA ccggtcggcc G - C T - A G - C G - C C - G T - A G - C T G T T G C C C A C G A A + | | | | G T C T T G G C G G G C G | | + | T T G G A G C T A A GTGTC C - G C - G A - T G - C G - C T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |