Sequence ID | >W1710086624 |
Genome ID | BDOG01000034 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium avium subsp. hominissuis [BDOG] |
Start position on genome | 56667 |
End posion on genome | 56740 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tgaagaacag |
tRNA gene sequence |
GCGCCCGTAGCTCAACGGATAGAGCATCTGACTACGGATCAGAAGGTTAGGGGTTCGAAT |
Downstream region at tRNA end position |
tttcagtcag |
Secondary structure (Cloverleaf model) | >W1710086624 Arg ACG g GCtt tttcagtcag G - C C - G G - C C - G C - G C - G G - C T A T T T C C C A C A A A | + | | | G G C T C G A G G G G C G | | | | T T A G A G C T A A AGGTT T - A C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |