Sequence ID | >W1710103891 |
Genome ID | CYZN01000003 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Blautia wexlerae [CYZN] |
Start position on genome | 371 |
End posion on genome | 446 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aaattatttT |
tRNA gene sequence |
GGCCCAGTGGCTCAGTTGGTTAGAGCGTCGCCCTGTCACGGCGAAGGTCGAGAGTTCGAG |
Downstream region at tRNA end position |
gcatttgctg |
Secondary structure (Cloverleaf model) | >W1710103891 Asp GTC T GTta gcatttgctg G - C G + T C - G C - G C - G A - T G - C T G T T T C T C A T G A G + | | | | G T C T C G G A G A G C G | | | | T T G G A G C T T A G AGGTC T - A C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |