Sequence ID | >W1710105279 |
Genome ID | CZAL01000002 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Fusicatenibacter saccharivorans [CZAL] |
Start position on genome | 141483 |
End posion on genome | 141568 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
actaagaaaT |
tRNA gene sequence |
GCAGGAGTGGCGGAATTGGCAGACGCGCAGGCTTCAGGTGCCTGTGGTCGCAAGATCGTG |
Downstream region at tRNA end position |
ttttttcgct |
Secondary structure (Cloverleaf model) | >W1710105279 Leu CAG T ATta ttttttcgct G - C C - G A - T G - C G - C A - T G - C T G T T A C C C A T A A G + | | | | A T G G C G G T G G G C G | | | T T G A C G C C A G G TGGTCGCAAGATCGT C - G A - T G - C G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |