| Sequence ID | >W1710113812 |
| Genome ID | CZIU01000021 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni [CZIU] |
| Start position on genome | 8644 |
| End posion on genome | 8569 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
ttagggttat |
| tRNA gene sequence |
GACCCTTTCGTCTAGTGGCCCAGGACAACACTCTCTCTGTGTGGAAACAGAGGTTCAAAT |
| Downstream region at tRNA end position |
atcataggtc |
| Secondary structure (Cloverleaf model) | >W1710113812 Arg TCT
t GCCA atcataggtc
G - C
A - T
C - G
C - G
C - G
T + G
T - A T A
T T C T C C A
T G A C | | | | | A
G T C T G A G A G G C
G | | + T T
C A G G A
C C C GAAAC
A G
A - T
C - G
A - T
C - G
T T
C C
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |