Sequence ID | >W1710129176 |
Genome ID | CZYG01000042 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile [CZYG] |
Start position on genome | 7977 |
End posion on genome | 7887 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
atagaaatat |
tRNA gene sequence |
GGAGAGGTACTCAAGTGGTAAAGAGGATAGTTTGCTAAACTATTAGGTCAATTAATTTGA |
Downstream region at tRNA end position |
ataaaaaaaa |
Secondary structure (Cloverleaf model) | >W1710129176 Ser GCT t TCCA ataaaaaaaa G + T G - C A - T G - C A - T G - C G - C T A T T T C C C A T G A A + | | | | A G A C T C G A G G G C G | | | T T T A G A G A A G TAGGTCAATTAATTTGATAC A - T T - A A - T G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |