Sequence ID | >W1710148080 |
Genome ID | FAGZ01000013 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile [FAGZ] |
Start position on genome | 6572 |
End posion on genome | 6490 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
taaaatataa |
tRNA gene sequence |
GCCGCTGTGGCGGAACTGGCATACGCATACGACTCAAAATCGTACGGGAAACCATATGGG |
Downstream region at tRNA end position |
ataaaaaaaa |
Secondary structure (Cloverleaf model) | >W1710148080 Leu CAA a ACCA ataaaaaaaa G - C C - G C - G G - C C - G T - A G - C T G T T A C C C A C A A G | | | | | G T G G C G A T G G G C G | | | T T G A C G C C A T A CGGGAAACCAT T - A A - T C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |