Sequence ID | >W1710150350 |
Genome ID | FAIB01000151 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile [FAIB] |
Start position on genome | 694 |
End posion on genome | 618 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
caccatttgc |
tRNA gene sequence |
GGCCTGGTAGTTCAGTTGGTTAGAATGCCAGCCTGTCACGCTGGAGGTCGAGGGTTCGAA |
Downstream region at tRNA end position |
aaataaaatg |
Secondary structure (Cloverleaf model) | >W1710150350 Asp GTC c GCCA aaataaaatg G - C G + T C - G C - G T - A G - C G - C C A T T T C C C A T G A A + | | | | G T C T T G G A G G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |