Sequence ID | >W1710151397 |
Genome ID | FAIN01000098 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile [FAIN] |
Start position on genome | 366 |
End posion on genome | 442 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aataagattt |
tRNA gene sequence |
CGAGGTGTAGCGCAGTTTGGTAGCGCACATGGTTTGGGACCATGGGGCCGGGGGTTCGAG |
Downstream region at tRNA end position |
atataaggtg |
Secondary structure (Cloverleaf model) | >W1710151397 Pro TGG t ACCA atataaggtg C - G G - C A - T G - C G - C T - A G - C T G T T T C C C A T G A A + + | | | G T C G C G G G G G G C T | | | | T T G G C G C G T A A GGGCC C - G A - T T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |