Sequence ID | >W1710164181 |
Genome ID | FAOE01000126 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile [FAOE] |
Start position on genome | 678 |
End posion on genome | 595 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aaaaaaatgc |
tRNA gene sequence |
GCGGATGTGGCGGAATTGGCAGACGCACTAGACTTAGGATCTAGCGCCATTGGCGTGGGG |
Downstream region at tRNA end position |
tttttgtttg |
Secondary structure (Cloverleaf model) | >W1710164181 Leu TAG c ACCA tttttgtttg G - C C - G G - C G - C A - T T - A G - C T C T T T C C C A T A A G + + | | | G T G G C G G G G G G C G | | | T T G A C G C C A G A CGCCATTGGCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |