| Sequence ID | >W1710169092 |
| Genome ID | FAZV01000006 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter coli [FAZV] |
| Start position on genome | 53913 |
| End posion on genome | 53826 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
atttttaatt |
| tRNA gene sequence |
AGACAGGTGTCCGAGCGGTTGAAGGAGCACGCCTGGAACGCGTGTAAAGTGCAAGCTTTC |
| Downstream region at tRNA end position |
ctattaactt |
| Secondary structure (Cloverleaf model) | >W1710169092 Ser GGA
t GCCA ctattaactt
A - T
G - C
A - T
C - G
A - T
G - C
G - C T A
T T T C C C A
C G A G + | | | | G
G G C C T G A G G G C
G | | | T T
T A G G A
T G A G TAAAGTGCAAGCTTTC
C - G
A - T
C - G
G - C
C - G
C C
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |