| Sequence ID | >W1710180304 |
| Genome ID | FBKX01000012 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter coli [FBKX] |
| Start position on genome | 230482 |
| End posion on genome | 230406 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
accatgcttt |
| tRNA gene sequence |
GCGGGAGTAGCTCAGTTGGCTAGAGCATCAGCCTTCCAAGCTGAGGGTCGCGGGTTCGAG |
| Downstream region at tRNA end position |
aagtttgact |
| Secondary structure (Cloverleaf model) | >W1710180304 Gly TCC
t TCCA aagtttgact
G - C
C - G
G - C
G - C
G - C
A - T
G + T T G
T T G C C C A
T G A A + | | | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
C T A A GGGTC
T - A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |