Sequence ID | >W1710182210 |
Genome ID | FBMU01000001 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter coli [FBMU] |
Start position on genome | 420509 |
End posion on genome | 420595 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cctttataaa |
tRNA gene sequence |
GCCTGAGTGGTGAAACTGGTAGACGCGCCAGACTCAAAATCTGGTAAGGGTAACCTTGTG |
Downstream region at tRNA end position |
ttccacttga |
Secondary structure (Cloverleaf model) | >W1710182210 Leu CAA a ACCA ttccacttga G - C C - G C - G T - A G - C A - T G - C T G T C A G C C A C A A G | | | | | G T A G T G G T C G G C G | + | T T G A C G C T A G G TAAGGGTAACCTTGT C - G C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |