Sequence ID | >W1710193621 |
Genome ID | FCFZ01000007 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Serratia marcescens [FCFZ] |
Start position on genome | 68888 |
End posion on genome | 68813 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ccacagcagt |
tRNA gene sequence |
GGGTGATTAGCTCAGTTGGTAGAGCATCTCCTTTACACGGAGGGGGTCGGCGGTTCGAGC |
Downstream region at tRNA end position |
ctgttatggg |
Secondary structure (Cloverleaf model) | >W1710193621 Val TAC t ACCA ctgttatggg G - C G - C G - C T - A G - C A - T T - A C G T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GGGTC T + G C - G T - A C - G C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |