Sequence ID | >WENV009362 |
Genome ID | AACY020251913 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 1881 |
End posion on genome | 1804 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aactctataT |
tRNA gene sequence |
AGGAGTGTAGCTCAATTGGTAGAGCGCCGGTCTCCAAAACCGGAGGCTGAGGGTTCGAGT |
Downstream region at tRNA end position |
Attagagcca |
Secondary structure (Cloverleaf model) | >WENV009362 Trp CCA T GCCA Attagagcca A - T G - C G - C A - T G - C T + G G - C T G T C T C C C A T A A A | | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A G AGGCT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |