Sequence ID | >W1710433796 |
Genome ID | FJMZ01000004 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Trichococcus flocculiformis [FJMZ] |
Start position on genome | 1303 |
End posion on genome | 1376 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ccctctttaT |
tRNA gene sequence |
TGGGCTATCGCCAAGCGGTAAGGCAACAGACTTTGACTCTGTCATTCGTTGGTTCGAATC |
Downstream region at tRNA end position |
tttcaaatag |
Secondary structure (Cloverleaf model) | >W1710433796 Gln TTG T GTtt tttcaaatag T - A G - C G - C G - C C - G T - A A - T T A T C G A C C A G A C | + | | | G C A C C G G T T G G C G | | | T T G A G G C T A A CATTC A - T C - G A - T G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |