Sequence ID | >W1710460073 |
Genome ID | FKJK01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Shewanella woodyi Alg231_23 [FKJK] |
Start position on genome | 1119876 |
End posion on genome | 1119951 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tcactcccgt |
tRNA gene sequence |
CTCCCTATAGCTCAACAGGATAGAGCAGTCGCCTCCTAAGCGATCGATCGGGGTTCGAGT |
Downstream region at tRNA end position |
aacttttcca |
Secondary structure (Cloverleaf model) | >W1710460073 Arg CCT t ACCA aacttttcca C - G T - A C - G C - G C - G T + G A - T T G T G T C C C A C A A A | + | | | G A C T C G C G G G G C G | | | | T T G G A G C A T A A CGAT G + T T - A C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |