Sequence ID | >W1710494760 |
Genome ID | FLKB01000018 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium nigeriense Marseille-P2414 [FLKB] |
Start position on genome | 24620 |
End posion on genome | 24547 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tccataatat |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCCCTTGCCTTCCAAGCAAGTTACGTGAGTTCGATTCT |
Downstream region at tRNA end position |
taaacataat |
Secondary structure (Cloverleaf model) | >W1710494760 Gly TCC t TCCA taaacataat G - C C - G G - C G - C G - C T - A G - C T T T T A C T C A A A A + | | | | G T C T C G G T G A G C G | | | | T T G G A G C T A C TTAC C - G T - A T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |