Sequence ID | >W1710497281 |
Genome ID | FLOV01000011 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Helicobacter pylori [FLOV] |
Start position on genome | 27974 |
End posion on genome | 27899 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tcaatatttt |
tRNA gene sequence |
GGTCGCTTAGCTCAGTTGGTAGAGCGCTACCCTTACAAGGTAGATGTCATAAGTTCGAGT |
Downstream region at tRNA end position |
tgactaaagc |
Secondary structure (Cloverleaf model) | >W1710497281 Val TAC t ACCA tgactaaagc G - C G - C T - A C - G G - C C - G T - A T G T T A T T C A T G A A | | | | | G T C T C G A T A A G C G | | | | T T G G A G C T A G ATGTC C - G T - A A - T C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |