Sequence ID | >W1710506987 |
Genome ID | FMUX01000009 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfoluna spongiiphila [FMUX] |
Start position on genome | 166966 |
End posion on genome | 166869 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
tgaaacgcat |
tRNA gene sequence |
GGAAGCACGCAGCGTTCTGGTGATGCTCCCGGACTTCAAATCCGGTGTGGGGCGTTAACA |
Downstream region at tRNA end position |
tatatctaat |
Secondary structure (Cloverleaf model) | >W1710506987 SeC(p) TCA t GCCA tatatctaat G - C G - C A - T A - T G - C C - G A - T C - G T T G T A C C C A C T T C + | | | | G T G C G A G T G G G C G + | | | T T G T G C T T G A C TGTGGGGCGTTAACACCGTCCCGG C - G C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |