Sequence ID | >W1710507011 |
Genome ID | FMUX01000022 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfoluna spongiiphila [FMUX] |
Start position on genome | 82921 |
End posion on genome | 82845 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tttaccttgc |
tRNA gene sequence |
AGGTCAGTAGCTCCAATTGGTAGAGCGTCGGTCTCCAAAACCGAATGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
caaaccttga |
Secondary structure (Cloverleaf model) | >W1710507011 Trp CCA c GCCA caaaccttga A - T G - C G - C T - A C - G A - T G - C T G T C T C C C A A A C A | + | | | G T C T C G G G G G G C T | | | | T T G G A G C G T A G ATGTT T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |