Sequence ID | >W1710507017 |
Genome ID | FMUX01000028 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfoluna spongiiphila [FMUX] |
Start position on genome | 32878 |
End posion on genome | 32794 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tctcacattt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACGCGCACGGTTGAGGGCCGTGTGGGGCAACCCGTGGG |
Downstream region at tRNA end position |
tttaaaagca |
Secondary structure (Cloverleaf model) | >W1710507017 Leu GAG t ACCA tttaaaagca G - C C - G C - G G - C A - T A - T G - C T G T C C C T C A T A A G | | | | | A T G G T G G G G A G C G | + | T T G A C G C T A G G TGGGGCAACCCGT C - G A - T C - G G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |