Sequence ID | >W1710507055 |
Genome ID | FMUY01000008 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Pseudobutyrivibrio sp. AR14 [FMUY] |
Start position on genome | 1823 |
End posion on genome | 1737 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aacagaatat |
tRNA gene sequence |
GGAGAGGTATCGAAGTGGTCATAACGAGGCGGTCTTGAAAACCGTTTGTCCGCAAGGGCG |
Downstream region at tRNA end position |
gataggcaat |
Secondary structure (Cloverleaf model) | >W1710507055 Ser TGA t GCtt gataggcaat G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A G T G A A | | | | | G G A G C T G T G G G C T | | | T T C A C G A A T A G TTGTCCGCAAGGGCGC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |