Sequence ID | >W1710508476 |
Genome ID | FMWD01000019 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Thiohalomonas denitrificans [FMWD] |
Start position on genome | 352 |
End posion on genome | 427 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tcgggttaaa |
tRNA gene sequence |
AGGCCAGTAGCTCAATTGGCAGAGCAGCGGTCTCCAAAACCGCAGGTTGGGGGTTCGATT |
Downstream region at tRNA end position |
ctttttgccc |
Secondary structure (Cloverleaf model) | >W1710508476 Trp CCA a GCCA ctttttgccc A - T G - C G - C C - G C - G A - T G - C T T T C T C C C A T A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |