Sequence ID | >W1710509722 |
Genome ID | FMXK01000008 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Butyrivibrio sp. INlla18 [FMXK] |
Start position on genome | 638 |
End posion on genome | 713 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tcgtgtgtaa |
tRNA gene sequence |
GCCGATGTGGCTCAATTGGCAGAGCAGCTGATTTGTAATCAGCAGGTTAACGGTTCGAGT |
Downstream region at tRNA end position |
tatggatggc |
Secondary structure (Cloverleaf model) | >W1710509722 Thr TGT a TCTA tatggatggc G - C C - G C - G G - C A - T T - A G - C T G T T C G C C A T A A G | | | | G T C T C G A A C G G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |