Sequence ID | >W1710509908 |
Genome ID | FMXO01000003 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfonatronum thiosulfatophilum [FMXO] |
Start position on genome | 96286 |
End posion on genome | 96211 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tctttacacg |
tRNA gene sequence |
GTGGGTGTAGCTCAGTAGGTAGAGCACCTGGTTGTGGCCCAGGCGGCCGCGCGTTCAAGT |
Downstream region at tRNA end position |
tgtatttaca |
Secondary structure (Cloverleaf model) | >W1710509908 His GTG g CCCA tgtatttaca G - C T - A G - C G - C G + T T - A G - C T G T T G C G C A T G A A + | | | | A A C T C G G C G C G C G | | | | T T G G A G C T A A CGGCC C - G C - G T - A G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |