Sequence ID | >W1710512319 |
Genome ID | FMZI01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Mameliella alba [FMZI] |
Start position on genome | 509728 |
End posion on genome | 509802 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cgccgcatgt |
tRNA gene sequence |
TCCGGCGTAGCTCAGCGGTAGAGCAGTTGACTGTTAATCAATTGGTCGTAGGTTCGATCC |
Downstream region at tRNA end position |
atcacctcta |
Secondary structure (Cloverleaf model) | >W1710512319 Asn GTT t GCCA atcacctcta T - A C - G C - G G - C G - C C - G G - C C T T C A T C C A G A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |