Sequence ID | >W1710512537 |
Genome ID | FMZM01000006 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Nocardioides lianchengensis [FMZM] |
Start position on genome | 274060 |
End posion on genome | 273974 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
acccgcactc |
tRNA gene sequence |
GTCCGGGTGGCGGAATTGGCAGACGCGCTAGCTTGAGGTGCTAGTGCCCTTTATCGGGCG |
Downstream region at tRNA end position |
gaaggccccg |
Secondary structure (Cloverleaf model) | >W1710512537 Leu GAG c ACtg gaaggccccg G - C T - A C - G C - G G - C G + T G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C C A G G TGCCCTTTATCGGGCGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |