| Sequence ID | >W1710513374 |
| Genome ID | FNAC01000002 |
| Phylum/Class | Bacteroidota |
| Species | Algoriphagus faecimaris [FNAC] |
| Start position on genome | 162916 |
| End posion on genome | 162840 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
aaatcttgtt |
| tRNA gene sequence |
CGGGGTGTAGCGTAGCCCGGTATCGCGCCACATTTGGGATGTGGAGGTCGTAGGTTCGAA |
| Downstream region at tRNA end position |
cttcatcaat |
| Secondary structure (Cloverleaf model) | >W1710513374 Pro TGG
t ACCA cttcatcaat
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T C G T C C A
C G A A | + | | | G
C T G C G G T A G G C
C | | | T T
G T C G C
G T A G AGGTC
C - G
C - G
A - T
C - G
A - T
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |