Sequence ID | >W1710514159 |
Genome ID | FNAS01000010 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Riemerella columbipharyngis [FNAS] |
Start position on genome | 33056 |
End posion on genome | 32972 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttatacaact |
tRNA gene sequence |
GCGGATGTGGTGTAATTGGTAGCCACGCCAGACTTAGGATCTGGTGCCGAGAGGCGTGGG |
Downstream region at tRNA end position |
ttgcgaaaat |
Secondary structure (Cloverleaf model) | >W1710514159 Leu TAG t ACAA ttgcgaaaat G - C C - G G - C G - C A - T T - A G - C T G T T T C C C A T A A G + + | | | G T T G T G G G G G G C G | | | T T G C C A C T A G G TGCCGAGAGGCGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |