Sequence ID | >W1710514655 |
Genome ID | FNBC01000023 |
Search identical group | |
Phylum/Class | Deinococcota |
Species | Thermus arciformis [FNBC] |
Start position on genome | 23326 |
End posion on genome | 23252 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cccccttctt |
tRNA gene sequence |
GGCCCCATCGTCTAGCGGTCAGGACGCGGCCCTCTCAAGGCCGAAACGGGGGTTCGATTC |
Downstream region at tRNA end position |
tgggcggcta |
Secondary structure (Cloverleaf model) | >W1710514655 Glu CTC t ACCA tgggcggcta G - C G + T C - G C - G C - G C - G A - T T T T C C C C C A C G A C | | | | | G G T C T G G G G G G C G + | | | T T T G G A C C A G AAAC C - G G - C G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |