Sequence ID | >W1710514951 |
Genome ID | FNBI01000010 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingomonas carotinifaciens S7-754 [FNBI] |
Start position on genome | 89740 |
End posion on genome | 89814 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cacgcctgac |
tRNA gene sequence |
GGCCCCTTCGTCTAGCGGTTAGGACGCGGCCCTTTCACGGCTGAAGCACGGGTTCGATTC |
Downstream region at tRNA end position |
ctcccacgcc |
Secondary structure (Cloverleaf model) | >W1710514951 Glu TTC c ACCA ctcccacgcc G - C G + T C - G C - G C - G C - G T - A T T T T G C C C A C G A C | | | | | G G T C T G A C G G G C G + | | | T T T G G A C T A G AAGC C - G G + T G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |