Sequence ID | >W1710527839 |
Genome ID | FNLL01000001 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfobacula phenolica [FNLL] |
Start position on genome | 329763 |
End posion on genome | 329672 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aatttaataa |
tRNA gene sequence |
GGAGAGGTGACCGAGATGGCTGAAGGTGCACGCCTGGAAAGCGTGTGTATCCTAACCGGG |
Downstream region at tRNA end position |
ctgatcataa |
Secondary structure (Cloverleaf model) | >W1710527839 Ser GGA a GCCA ctgatcataa G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T A G A G | | | | | G G G C C A G A G G G C G | | | T T C A G G T T G A G TGTATCCTAACCGGGTACC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |