Sequence ID | >W1710528898 |
Genome ID | FNNP01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Ruegeria halocynthiae [FNNP] |
Start position on genome | 1777075 |
End posion on genome | 1776999 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tcaccaacgc |
tRNA gene sequence |
GGACCGATAGCTCAGCTGGATAGAGTACTTGACTACGAATCAAGGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
cttatctctt |
Secondary structure (Cloverleaf model) | >W1710528898 Arg ACG c GCCA cttatctctt G - C G - C A - T C - G C - G G - C A - T T A T C C T C C A C G A A | | + | | G T C T C G G G G G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |