Sequence ID | >W1710530031 |
Genome ID | FNOL01000009 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Variovorax sp. YR634 [FNOL] |
Start position on genome | 71053 |
End posion on genome | 71126 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
atttctgcgt |
tRNA gene sequence |
GGCGCGATAGCAAAGCGGTTATGCAACGGATTGCAAATCCGTCTAGCCCGGTTCGACTCC |
Downstream region at tRNA end position |
ctctctcggt |
Secondary structure (Cloverleaf model) | >W1710530031 Cys GCA t TCCA ctctctcggt G - C G - C C - G G - C C - G G - C A - T T C T G G G C C A G A A | | | | | G C A A C G C C C G G C G | | | T T G A T G C T T A CTAG A - T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |