Sequence ID | >W1710531652 |
Genome ID | FNPS01000002 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium aquidurense [FNPS] |
Start position on genome | 247744 |
End posion on genome | 247669 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aagaaaaatg |
tRNA gene sequence |
GTGGTTGTAGCTCAGCTGGTTAGAGTATTGGTTTGTGGTGCCGAGGGTCGCCGGTTCGAA |
Downstream region at tRNA end position |
aaatttaaag |
Secondary structure (Cloverleaf model) | >W1710531652 His GTG g CCAg aaatttaaag G - C T - A G - C G - C T + G T - A G - C C A T T G G C C A C G A A + | | | | G T C T C G G C C G G C G | | | + T T G G A G T T T A A GGGTC T - A T + G G - C G - C T + G T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |