Sequence ID | >W1710532348 |
Genome ID | FNQG01000006 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Selenomonas ruminantium [FNQG] |
Start position on genome | 147210 |
End posion on genome | 147125 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cgaataaatc |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGCAGACGCGCTACTTTGAGGGGGTAGTGTTCACAAGACGTAT |
Downstream region at tRNA end position |
attaagaatt |
Secondary structure (Cloverleaf model) | >W1710532348 Leu GAG c ACCA attaagaatt G - C C - G G - C G - C T - A C - G G - C T G T T A C C C A T A A G | | | | | A T G G C G A T G G G C G | | | T T G A C G C C A G G TGTTCACAAGACGT C - G T - A A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |