Sequence ID | >W1710534878 |
Genome ID | FNSD01000001 |
Search identical group | |
Phylum/Class | Acidobacteriota |
Species | Terriglobus roseus [FNSD] |
Start position on genome | 4607070 |
End posion on genome | 4606994 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atattggtta |
tRNA gene sequence |
TGCGGGGTGGAGCAGCCCGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
aacaacttgt |
Secondary structure (Cloverleaf model) | >W1710534878 Met CAT a ACCA aacaacttgt T - A G - C C - G G - C G - C G - C G - C T A T C A T C C A C G A G | | | | | A C C G A G G T A G G C C | | | | T T G G C T C G T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |