Sequence ID | >W1710535933 |
Genome ID | FNSW01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Paenibacillus sp. GP183 [FNSW] |
Start position on genome | 4636555 |
End posion on genome | 4636630 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aattgaatat |
tRNA gene sequence |
GCCGTTGTAGCTCAACTGGTAGAGCAACTGACTTGTAATCAGTAGGTTGGGGGTTCAAGT |
Downstream region at tRNA end position |
tgttttatgg |
Secondary structure (Cloverleaf model) | >W1710535933 Thr TGT t ACCA tgttttatgg G - C C - G C - G G - C T - A T + G G - C T G T T C T C C A C A A A + | + | | A T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTT A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |