Sequence ID | >W1710538275 |
Genome ID | FNUK01000021 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Caloramator fervidus [FNUK] |
Start position on genome | 15929 |
End posion on genome | 15855 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
actgaggttt |
tRNA gene sequence |
GGCCCCTTGGTCAAGTGGTTAAGACACCACCCTTTCACGGTGGTAACAGGGGTTCGAATC |
Downstream region at tRNA end position |
tgtgggcgcc |
Secondary structure (Cloverleaf model) | >W1710538275 Glu TTC t ACCA tgtgggcgcc G - C G + T C - G C - G C - G C - G T - A T A T T C C C C A T G A G | | | | | G G A C T G A G G G G C G | | | T T T A G A C T A A TAAC C - G C - G A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |