Sequence ID | >W1710538290 |
Genome ID | FNUK01000037 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Caloramator fervidus [FNUK] |
Start position on genome | 9808 |
End posion on genome | 9732 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgggtaagaa |
tRNA gene sequence |
GGGCCTTTAGCTCAGTTGGCTAGAGCAACCGGCTCATAACCGGTCGGTCCGGGGTTCGAG |
Downstream region at tRNA end position |
tgtgggggtg |
Secondary structure (Cloverleaf model) | >W1710538290 Met CAT a ACCA tgtgggggtg G - C G - C G - C C - G C - G T - A T - A T G T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C C T A A CGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |