Sequence ID | >W1710538806 |
Genome ID | FNUV01000005 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Xylanibacter ruminicola [FNUV] |
Start position on genome | 25257 |
End posion on genome | 25331 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
agtgctttct |
tRNA gene sequence |
GGTGCGTTAGTTCAGTAGGTTAGAATGCCTGCCTGTCACGCAGGAGGTCACGAGTTCGAA |
Downstream region at tRNA end position |
ttttttttca |
Secondary structure (Cloverleaf model) | >W1710538806 Asp GTC t GCag ttttttttca G - C G - C T - A G - C C - G G - C T - A T A T T G C T C A T G A A | | | | | G A C T T G A C G A G C G | | | + T T G G A A T T T A G AGGTC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |