| Sequence ID | >W1710539045 |
| Genome ID | FNVA01000002 |
| Phylum/Class | Acidobacteriota |
| Species | Bryocella elongata [FNVA] |
| Start position on genome | 578620 |
| End posion on genome | 578544 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
atactgattt |
| tRNA gene sequence |
TGCGGGGTGGAGCAGCCCGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGCAGGTTCAAA |
| Downstream region at tRNA end position |
attacaagat |
| Secondary structure (Cloverleaf model) | >W1710539045 Met CAT
t ACCA attacaagat
T - A
G - C
C - G
G - C
G - C
G - C
G - C T A
T C G T C C A
C G A G | | | | | A
C C G A G G C A G G C
C | | | | T T
G G C T C
G T A G AGGTC
T - A
T - A
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |