Sequence ID | >W1710539664 |
Genome ID | FNVP01000002 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium urumqiense [FNVP] |
Start position on genome | 373425 |
End posion on genome | 373501 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gatctagttt |
tRNA gene sequence |
GGGGGATTAGCTCATTTGGCTAGAGTGCTTGCCTGGCAGGCAAGAGGTGATCGGTTCGAA |
Downstream region at tRNA end position |
aaaaaccgta |
Secondary structure (Cloverleaf model) | >W1710539664 Ala GGC t ACAA aaaaaccgta G - C G - C G + T G - C G + T A - T T - A T A T T A G C C A T T A A | | | | | G T C T C G A T C G G C G | | | + T T G G A G T C T A G AGGTG C - G T - A T - A G - C C - G C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |