Sequence ID | >W1710548822 |
Genome ID | FOEB01000009 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Methylobacterium sp. ap11 [FOEB] |
Start position on genome | 68398 |
End posion on genome | 68472 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ccggctcaca |
tRNA gene sequence |
GGGCGCGTAGCTCAGCGGGAGAGCATTCGCTTCACACGCGAAGGGTCACAGGTTCAATCC |
Downstream region at tRNA end position |
cccttgatac |
Secondary structure (Cloverleaf model) | >W1710548822 Val CAC a ACCA cccttgatac G - C G - C G - C C - G G - C C - G G - C C T T T G T C C A G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC T - A T - A C - G G - C C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |