Sequence ID | >W1710552369 |
Genome ID | FOGU01000006 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Tranquillimonas rosea roseus [FOGU] |
Start position on genome | 115035 |
End posion on genome | 114961 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cccaacggat |
tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCATTACCTTGCCAAGGTAAGGGTCGTGAGTTCGAATC |
Downstream region at tRNA end position |
atttgggacc |
Secondary structure (Cloverleaf model) | >W1710552369 Gly GCC t TCCA atttgggacc G - C C - G G - C G - C G - C C - G G - C T A T T A C T C A G A A + | | | | G G C T C G G T G A G C G | | | | T T G G A G C T A A GGGTC T - A T - A A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |