Sequence ID | >W1710552449 |
Genome ID | FOGW01000004 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lachnobacterium bovis [FOGW] |
Start position on genome | 142642 |
End posion on genome | 142569 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gaaataatat |
tRNA gene sequence |
GCGACAGTGGCGTAGTTGGTAACGCGCGACCTTGCCAAGGTCGAGACCGCGGGTTCGAGC |
Downstream region at tRNA end position |
aagaggttcc |
Secondary structure (Cloverleaf model) | >W1710552449 Gly GCC t TCtt aagaggttcc G - C C - G G - C A - T C - G A - T G - C C G T T G C C C A T G A G + | | | | G T T G C G G C G G G C G | | | | T T G A C G C T A G AGACC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |