Sequence ID | >W1710557632 |
Genome ID | FOLE01000004 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flexibacter flexilis DSM 6793 [FOLE] |
Start position on genome | 210975 |
End posion on genome | 211050 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aaaccaaaat |
tRNA gene sequence |
TGTCCGATGGTGTAACTGGCAACACGTCTGATTTTGGTTCAGAAGAGTCCAGGTTCGAAA |
Downstream region at tRNA end position |
gaagccttaa |
Secondary structure (Cloverleaf model) | >W1710557632 Gln TTG t ACGA gaagccttaa T - A G - C T - A C - G C - G G - C A - T A A T G G T C C A C A A G | | | | | G T T G T G C C A G G C G | | | | T T G A C A C C A G AGAGT T - A C - G T - A G - C A - T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |