| Sequence ID | >W1710561616 |
| Genome ID | FOOH01000004 |
| Phylum/Class | Bacteroidota |
| Species | Salegentibacter agarivorans [FOOH] |
| Start position on genome | 184071 |
| End posion on genome | 183984 |
| Amino Acid | Ser |
| Anticodon | TGA |
| Upstream region at tRNA start position |
gcattttatt |
| tRNA gene sequence |
GGAGGAATGGCAGAGTGGTCGATTGCGGCAGTCTTGAAAACTGTTGACTGTAACAGGTCC |
| Downstream region at tRNA end position |
attacactac |
| Secondary structure (Cloverleaf model) | >W1710561616 Ser TGA
t GCCA attacactac
G - C
G - C
A - T
G - C
G - C
A - T
A - T T A
T C T C C C A
T G A G | + | | | G
G G A C G G G G G G C
G + | | | T T
T T T G C
C G A G TGACTGTAACAGGTCC
G + T
C - G
A - T
G - C
T - A
C A
T A
T G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |